| Accession | MI0002692 |
| Name | ppy-mir-95 |
| similar to following miRCarta precursors | ppy-328.1 |
| Organism | Pongo abelii |
| Genome | PPYG2 |
| Location |
4:5,076,923-5,077,003 (+) |
| miRNA | ppy-miR-95 |
| Sequence (5' -> 3') (81 nts) |
AACACAGUGGGCACUCAAUAAAUGUCUGUUGAAUUGAAAUGCGUUACAUUCAACGGGUAUUUAUUGAGCACCCACUCUGUG |
| MFE | -36.40 kcal/mol |
| first miRBase version | 7.0 |
| last miRBase version | 21.0 |
| Clusters (10 kb) (1 precursors) |
ppy-mir-95 |
| Family | mir-95 (MIPF0000098) |
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Berezikov et al. | Cell | 2005 | 15652478 | Phylogenetic shadowing and computational identification of human microRNA genes. |