Precursor miRBase

ggo-mir-33 (MI0002686)

Accession MI0002686
Name ggo-mir-33
similar to following miRCarta precursors ggo-257.1
Organism Gorilla gorilla
Genome GorGor3
Location 22:26,270,320-26,270,388 (+)
miRNA ggo-miR-33
Sequence (5' -> 3')
(69 nts)
CUGUGGUGCAUUGUAGUUGCAUUGCAUGUUCUGGUGGUACCCAUGCAAUGUUUCCACAGUGCAUCACAG
MFE -35.60 kcal/mol
first miRBase version 7.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
ggo-mir-33
Family mir-33 (MIPF0000070)
External DBs
Gene symbol MIR33
NCBI Gene 102464136

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Berezikov et al. Cell 2005 15652478 Phylogenetic shadowing and computational identification of human microRNA genes.