| Accession | MI0002668 | ||||
| Name | ggo-mir-30a | ||||
| similar to following miRCarta precursors | ggo-15-38.1 | ||||
| Organism | Gorilla gorilla | ||||
| Genome | GorGor3 | ||||
| Locations |
6:71,100,287-71,100,357 (-) 6:71,103,032-71,103,102 (-) |
||||
| miRNA | ggo-miR-30a-5p | ||||
| miRNA | ggo-miR-30a-3p | ||||
| Sequence (5' -> 3') (71 nts) |
GCGACUGUAAACAUCCUCGACUGGAAGCUGUGAAGCCACAGAUGGGCUUUCAGUCGGAUGUUUGCAGCUGC | ||||
| MFE | -37.20 kcal/mol | ||||
| first miRBase version | 7.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
ggo-mir-30a ggo-mir-30a |
||||
| Family | mir-30 (MIPF0000005) | ||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Berezikov et al. | Cell | 2005 | 15652478 | Phylogenetic shadowing and computational identification of human microRNA genes. |