| Accession | MI0002661 | ||||
| Name | ptr-mir-29a | ||||
| similar to following miRCarta precursors | ptr-27521.1 | ||||
| Organism | Pan troglodytes | ||||
| Genome | CHIMP2.1.4 | ||||
| Location |
7:132,365,015-132,365,078 (-) |
||||
| miRNA | ptr-miR-29a | ||||
| Sequence (5' -> 3') (64 nts) |
AUGACUGAUUUCUUUUGGUGUUCAGAGUCAAUAUAAUUUUCUAGCACCAUCUGAAAUCGGUUAU | ||||
| MFE | -24.60 kcal/mol | ||||
| first miRBase version | 7.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
ptr-mir-29a ptr-mir-29b-1 |
||||
| Family | mir-29 (MIPF0000009) | ||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Berezikov et al. | Cell | 2005 | 15652478 | Phylogenetic shadowing and computational identification of human microRNA genes. |