| Accession | MI0002660 |
| Name | ppy-mir-29a |
| similar to following miRCarta precursors | ppy-27521.1 |
| Organism | Pongo abelii |
| Genome | PPYG2 |
| Location |
7:127,858,405-127,858,468 (-) |
| miRNA | ppy-miR-29a |
| Sequence (5' -> 3') (64 nts) |
AUGACUGAUUUCUUUUGGUGUUCAGAGUCAAUAUAAUUUUCUAGCACCAUCUGAAAUCGGUUAU |
| MFE | -24.60 kcal/mol |
| first miRBase version | 7.0 |
| last miRBase version | 21.0 |
| Clusters (10 kb) (2 precursors) |
ppy-mir-29a ppy-mir-29b-1 |
| Family | mir-29 (MIPF0000009) |
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Berezikov et al. | Cell | 2005 | 15652478 | Phylogenetic shadowing and computational identification of human microRNA genes. |