Precursor miRBase

  1. Dashboard
  2. Precursor

ggo-mir-28 (MI0002651)

Accession MI0002651
Name ggo-mir-28
similar to following miRCarta precursors ggo-133.1
Organism Gorilla gorilla
Genome GorGor3
Location 3:190,252,815-190,252,900 (+)
miRNA ggo-miR-28
Sequence (5' -> 3')
(86 nts)		 GGUCCUUGCCCUCAAGGAGCUCACAGUCUAUUGAGUUACCUUUCUGACUUUCCCACUAGAUUGUGAGCUCCUGGAGGGCAGGCACU
MFE -50.20 kcal/mol
first miRBase version 7.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors) 		ggo-mir-28
Family mir-28 (MIPF0000057)
Experiments
experiment Pubmed link
Illumina 22453055
External DBs
Gene symbol MIR28
NCBI Gene 102464129

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Berezikov et al. Cell 2005 15652478 Phylogenetic shadowing and computational identification of human microRNA genes.
2 Dannemann et al. BMC Genomics 2012 22453055 Annotation of primate miRNAs by high throughput sequencing of small RNA libraries.
Imprint Data protection