Accession | MI0002643 |
Name | ppy-mir-26a |
similar to following miRCarta precursors | ppy-34.1 |
Organism | Pongo abelii |
Genome | PPYG2 |
Location |
3:108,740,900-108,740,976 (-) |
miRNA | ppy-miR-26a |
Sequence (5' -> 3') (77 nts) |
GUGGCCUCGUUCAAGUAAUCCAGGAUAGGCUGUGCAGGUCCCAAUGGGCCUAUUCUUGGUUACUUGCACGGGGACGC |
MFE | -37.30 kcal/mol |
first miRBase version | 7.0 |
last miRBase version | 21.0 |
Clusters (10 kb) (1 precursors) |
ppy-mir-26a |
Family | mir-26 (MIPF0000043) |
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Berezikov et al. | Cell | 2005 | 15652478 | Phylogenetic shadowing and computational identification of human microRNA genes. |