Precursor miRBase

ggo-mir-26a (MI0002642)

Accession MI0002642
Name ggo-mir-26a
similar to following miRCarta precursors ggo-34.1
Organism Gorilla gorilla
Genome GorGor3
Location 3:38,998,578-38,998,654 (+)
miRNA ggo-miR-26a
Sequence (5' -> 3')
(77 nts)
GUGGCCUCGUUCAAGUAAUCCAGGAUAGGCUGUGCAGGUCCCAAUGGGCCUAUUCUUGGUUACUUGCACGGGGACGC
MFE -37.30 kcal/mol
first miRBase version 7.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
ggo-mir-26a
Family mir-26 (MIPF0000043)
External DBs
Gene symbol MIR26A
NCBI Gene 102466283

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Berezikov et al. Cell 2005 15652478 Phylogenetic shadowing and computational identification of human microRNA genes.