Accession | MI0002632 |
Name | ppy-mir-22 |
similar to following miRCarta precursors | ppy-2.1 |
Organism | Pongo abelii |
Genome | PPYG2 |
Location |
17:1,575,636-1,575,720 (-) |
miRNA | ppy-miR-22 |
Sequence (5' -> 3') (85 nts) |
GGCUGAGCCGCAGUAGUUCUUCAGUGGCAAGCUUUAUGUCCUGACCCAGCUAAAGCUGCCAGUUGAAGAACUGUUGCCCUCUGCC |
MFE | -39.80 kcal/mol |
first miRBase version | 7.0 |
last miRBase version | 21.0 |
Clusters (10 kb) (1 precursors) |
ppy-mir-22 |
Family | mir-22 (MIPF0000053) |
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Berezikov et al. | Cell | 2005 | 15652478 | Phylogenetic shadowing and computational identification of human microRNA genes. |