| Accession | MI0002623 | ||||
| Name | ggo-mir-21 | ||||
| similar to following miRCarta precursors | ggo-1.1 | ||||
| Organism | Gorilla gorilla | ||||
| Genome | GorGor3 | ||||
| Location |
5:24,023,578-24,023,649 (-) |
||||
| miRNA | ggo-miR-21 | ||||
| Sequence (5' -> 3') (72 nts) |
UGUCGGGUAGCUUAUCAGACUGAUGUUGACUGUUGAAUCUCAUGGCAACACCAGUCGAUGGGCUGUCUGACA | ||||
| MFE | -34.60 kcal/mol | ||||
| first miRBase version | 7.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
ggo-mir-21 |
||||
| Family | mir-21 (MIPF0000060) | ||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Berezikov et al. | Cell | 2005 | 15652478 | Phylogenetic shadowing and computational identification of human microRNA genes. |