Accession | MI0002619 |
Name | ppy-mir-206 |
similar to following miRCarta precursors | ppy-817.1 |
Organism | Pongo abelii |
Genome | PPYG2 |
Location |
6:52,482,243-52,482,328 (+) |
miRNA | ppy-miR-206 |
Sequence (5' -> 3') (86 nts) |
UGCUUCCCGAGGCCACAUGCUUCUUUAUAUCCCCAUAUGGAUUACUUUGCUAUGGAAUGUAAGGAAGUGUGUGGUUUCGGCAAGUG |
MFE | -43.70 kcal/mol |
first miRBase version | 7.0 |
last miRBase version | 21.0 |
Clusters (10 kb) (2 precursors) |
ppy-mir-206 ppy-mir-133b |
Family | mir-1 (MIPF0000038) |
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Berezikov et al. | Cell | 2005 | 15652478 | Phylogenetic shadowing and computational identification of human microRNA genes. |