Accession | MI0002602 | ||||
Name | ptr-mir-184 | ||||
similar to following miRCarta precursors | ptr-460.1 | ||||
Organism | Pan troglodytes | ||||
Genome | CHIMP2.1.4 | ||||
Location |
15:76,852,043-76,852,126 (+) |
||||
miRNA | ptr-miR-184 | ||||
Sequence (5' -> 3') (84 nts) |
CCAGUCACGUCCCCUUAUCACUUUUCCAGCCCAGCUUUGUGACUGUAAGUGUUGGACGGAGAACUGAUAAGGGUAGGUGAUUGA | ||||
MFE | -35.80 kcal/mol | ||||
first miRBase version | 7.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (1 precursors) |
ptr-mir-184 |
||||
Family | mir-184 (MIPF0000059) | ||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Berezikov et al. | Cell | 2005 | 15652478 | Phylogenetic shadowing and computational identification of human microRNA genes. |