Precursor miRBase

ppa-mir-136 (MI0002596)

Accession MI0002596
Name ppa-mir-136
similar to following miRCarta precursors ppa-269.1
Organism Pan paniscus
miRNA ppa-miR-136
Sequence (5' -> 3')
(82 nts)
UGAGCCCUCGGAGGACUCCAUUUGUUUUGAUGAUGGAUUCUUAUGCUCCAUCAUCGUCUCAAAUGAGUCUUCAGAGGGUUCU
MFE -45.50 kcal/mol
first miRBase version 7.0
last miRBase version 21.0
Family mir-136 (MIPF0000099)
External DBs
Gene symbol MIR136
NCBI Gene 102464118

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Berezikov et al. Cell 2005 15652478 Phylogenetic shadowing and computational identification of human microRNA genes.