Accession | MI0002583 | ||||
Name | ptr-mir-127 | ||||
similar to following miRCarta precursors | ptr-80.1 | ||||
Organism | Pan troglodytes | ||||
Genome | CHIMP2.1.4 | ||||
Location |
14:100,574,290-100,574,386 (+) |
||||
miRNA | ptr-miR-127 | ||||
Sequence (5' -> 3') (97 nts) |
UGUGAUCACUGUCUCCAGCCUGCUGAAGCUCAGAGGGCUCUGAUUCAGAAAGAUCAUCGGAUCCGUCUGAGCUUGGCUGGUCGGAAGUCUCAUCAUC | ||||
MFE | -40.70 kcal/mol | ||||
first miRBase version | 7.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (7 precursors) |
ptr-mir-337
ptr-mir-665 ptr-mir-431 ptr-mir-433 ptr-mir-127 ptr-mir-432 ptr-mir-136 |
||||
Family | mir-127 (MIPF0000080) | ||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Berezikov et al. | Cell | 2005 | 15652478 | Phylogenetic shadowing and computational identification of human microRNA genes. |