Precursor miRBase

ggo-mir-9 (MI0002570)

Accession MI0002570
Name ggo-mir-9
similar to following miRCarta precursors ggo-104.1
Organism Gorilla gorilla
Genome GorGor3
Location 5:71,485,843-71,485,929 (-)
miRNA ggo-miR-9
Sequence (5' -> 3')
(87 nts)
GGAAGCGAGUUGUUAUCUUUGGUUAUCUAGCUGUAUGAGUGUAUUGGUCUUCAUAAAGCUAGAUAACCGAAAGUAAAAACUCCUUCA
MFE -38.90 kcal/mol
first miRBase version 7.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
ggo-mir-9
Family mir-9 (MIPF0000014)
External DBs
Gene symbol MIR9
NCBI Gene 102464115

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Berezikov et al. Cell 2005 15652478 Phylogenetic shadowing and computational identification of human microRNA genes.