| Accession | MI0002569 | ||||
| Name | ptr-mir-9-2 | ||||
| similar to following miRCarta precursors | ptr-104.2 | ||||
| Organism | Pan troglodytes | ||||
| Genome | CHIMP2.1.4 | ||||
| Location |
5:26,773,930-26,774,016 (+) |
||||
| miRNA | ptr-miR-9 | ||||
| Sequence (5' -> 3') (87 nts) |
GGAAGCGAGUUGUUAUCUUUGGUUAUCUAGCUGUAUGAGUGUAUUGGUCUUCAUAAAGCUAGAUAACCGAAAGUAAAAACUCCUUCA | ||||
| MFE | -38.90 kcal/mol | ||||
| first miRBase version | 7.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
ptr-mir-9-2 |
||||
| Family | mir-9 (MIPF0000014) | ||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Berezikov et al. | Cell | 2005 | 15652478 | Phylogenetic shadowing and computational identification of human microRNA genes. |