Accession | MI0002500 |
Name | ppy-mir-23b |
similar to following miRCarta precursors | ppy-42.1 |
Organism | Pongo abelii |
Genome | PPYG2 |
Location |
9:91,048,574-91,048,670 (+) |
miRNA | ppy-miR-23b |
Sequence (5' -> 3') (97 nts) |
CUCAGGUGCUCUGGCUGCUUGGGUUCCUGGCAUGCUGAUUUGUGACUUAAGAUUAAAAUCACAUUGCCAGGGAUUACCACGCAACCACGACCUUGGC |
MFE | -35.50 kcal/mol |
first miRBase version | 7.0 |
last miRBase version | 21.0 |
Clusters (10 kb) (3 precursors) |
ppy-mir-23b ppy-mir-27b ppy-mir-24-1 |
Family | mir-23 (MIPF0000027) |
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Berezikov et al. | Cell | 2005 | 15652478 | Phylogenetic shadowing and computational identification of human microRNA genes. |