| Accession | MI0002494 |
| Name | ppy-mir-15b |
| similar to following miRCarta precursors | ppy-110.1 |
| Organism | Pongo abelii |
| Genome | PPYG2 |
| Location |
3:163,674,098-163,674,195 (+) |
| miRNA | ppy-miR-15b |
| Sequence (5' -> 3') (98 nts) |
UUGAGGCCUUAAAGUACUGUAGCAGCACAUCAUGGUUUACAUGCUACAGUCAAGAUGCGAAUCAUUAUUUGCUGCUCUAGAAAUUUAAGGAAAUUCAU |
| MFE | -29.30 kcal/mol |
| first miRBase version | 7.0 |
| last miRBase version | 21.0 |
| Clusters (10 kb) (2 precursors) |
ppy-mir-15b ppy-mir-16-2 |
| Family | mir-15 (MIPF0000006) |
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Berezikov et al. | Cell | 2005 | 15652478 | Phylogenetic shadowing and computational identification of human microRNA genes. |