| Accession | MI0002488 |
| Name | ppy-mir-200c |
| similar to following miRCarta precursors | ppy-28860.1 |
| Organism | Pongo abelii |
| Genome | PPYG2 |
| Location |
12:7,199,699-7,199,766 (+) |
| miRNA | ppy-miR-200c |
| Sequence (5' -> 3') (68 nts) |
CCCUCGUCUUACCCAGCAGUGUUUGGGUGCGGUUGGGAGUCUCUAAUACUGCCGGGUAAUGAUGGAGG |
| MFE | -30.80 kcal/mol |
| first miRBase version | 7.0 |
| last miRBase version | 21.0 |
| Clusters (10 kb) (2 precursors) |
ppy-mir-200c ppy-mir-141 |
| Family | mir-8 (MIPF0000019) |
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Berezikov et al. | Cell | 2005 | 15652478 | Phylogenetic shadowing and computational identification of human microRNA genes. |