Accession | MI0002466 | ||||
Name | hsa-mir-376b | ||||
similar to following miRCarta precursors | hsa-814-636.1 | ||||
Organism | Homo sapiens | ||||
Genome | GRCh38.p10 | ||||
Location |
chr14:101,040,436-101,040,535 (+) |
||||
miRNA | hsa-miR-376b-5p | ||||
miRNA | hsa-miR-376b-3p | ||||
Sequence (5' -> 3') (100 nts) |
CAGUCCUUCUUUGGUAUUUAAAACGUGGAUAUUCCUUCUAUGUUUACGUGAUUCCUGGUUAAUCAUAGAGGAAAAUCCAUGUUUUCAGUAUCAAAUGCUG | ||||
MFE | -33.60 kcal/mol | ||||
first miRBase version | 7.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (16 precursors) |
hsa-mir-543
hsa-mir-495 hsa-mir-376c hsa-mir-376a-2 hsa-mir-654 hsa-mir-376b hsa-mir-376a-1 hsa-mir-300 hsa-mir-1185-1 hsa-mir-1185-2 hsa-mir-381 hsa-mir-487b hsa-mir-539 hsa-mir-889 hsa-mir-544a hsa-mir-655 |
||||
Family | mir-368 (MIPF0000091) | ||||
Experiments |
|
||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Altuvia et al. | Nucleic Acids Res. | 2005 | 15891114 | Clustering and conservation patterns of human microRNAs. |
2 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
3 | Kawahara et al. | Science | 2007 | 17322061 | Redirection of silencing targets by adenosine-to-inosine editing of miRNAs. |
4 | Voellenkle et al. | RNA | 2012 | 22282338 | Deep-sequencing of endothelial cells exposed to hypoxia reveals the complexity of known and novel microRNAs. |