| Accession | MI0002465 | ||||
| Name | hsa-mir-410 | ||||
| similar to following miRCarta precursors | hsa-1129-302.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr14:101,065,912-101,065,991 (+) |
||||
| miRNA | hsa-miR-410-5p | ||||
| miRNA | hsa-miR-410-3p | ||||
| Sequence (5' -> 3') (80 nts) |
GGUACCUGAGAAGAGGUUGUCUGUGAUGAGUUCGCUUUUAUUAAUGACGAAUAUAACACAGAUGGCCUGUUUUCAGUACC | ||||
| MFE | -35.80 kcal/mol | ||||
| first miRBase version | 7.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (10 precursors) |
hsa-mir-323b
hsa-mir-154 hsa-mir-496 hsa-mir-377 hsa-mir-541 hsa-mir-409 hsa-mir-412 hsa-mir-369 hsa-mir-410 hsa-mir-656 |
||||
| Family | mir-154 (MIPF0000018) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Bentwich et al. | Nat. Genet. | 2005 | 15965474 | Identification of hundreds of conserved and nonconserved human microRNAs. |
| 2 | Altuvia et al. | Nucleic Acids Res. | 2005 | 15891114 | Clustering and conservation patterns of human microRNAs. |
| 3 | Fu et al. | FEBS Lett. | 2005 | 15978578 | Identification of human fetal liver miRNAs by a novel method. |
| 4 | Sewer et al. | BMC Bioinformatics | 2005 | 16274478 | Identification of clustered microRNAs using an ab initio prediction method. |
| 5 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 6 | Meunier et al. | Genome Res. | 2013 | 23034410 | Birth and expression evolution of mammalian microRNA genes. |