Precursor miRBase

ssc-mir-107 (MI0002449)

Accession MI0002449
Name ssc-mir-107
similar to following miRCarta precursors ssc-78.1
Organism Sus scrofa
Genome Sscrofa10.2
Location chr14:110,407,095-110,407,181 (-)
miRNA ssc-miR-107
Sequence (5' -> 3')
(87 nts)
UUCUCUCUGCUUUCAGCUUCUUUACAGUGUUGCCUUGUGGCAUGGAGUUCAAGCAGCAUUGUACAGGGCUAUCAAAGCACAGAGAGC
MFE -35.00 kcal/mol
first miRBase version 7.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
ssc-mir-107
Family mir-103 (MIPF0000024)
Experiments
experiment Pubmed link
Illumina 24499489 19917043 21312241
cloned 18548309
454 19196471
External DBs
Gene symbol MIR107
NCBI Gene 100170413

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Wernersson et al. BMC Genomics 2005 15885146 Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing.
2 Kim et al. Mamm. Genome 2008 18548309 Identification and characterization of new microRNAs from pig.
3 Reddy et al. BMC Genomics 2009 19196471 Cloning, characterization and expression analysis of porcine microRNAs.
4 Nielsen et al. Anim. Genet. 2010 19917043 MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing.
5 Li et al. J. Cell. Biochem. 2011 21312241 MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing.
6 Chen et al. BMC Genomics 2014 24499489 Exploration of microRNAs in porcine milk exosomes.