Accession | MI0002445 | ||||||||
Name | ssc-let-7c | ||||||||
similar to following miRCarta precursors | ssc-37.1 | ||||||||
potential naming conflicts with | ssc-let-7c (MIMAT0002151) | ||||||||
Organism | Sus scrofa | ||||||||
Genome | Sscrofa10.2 | ||||||||
Location |
chr13:191,559,336-191,559,429 (+) |
||||||||
miRNA | ssc-let-7c | ||||||||
Sequence (5' -> 3') (94 nts) |
UGUGUGCAUCCGGGUUGAGGUAGUAGGUUGUAUGGUUUAGAGUUACACCGUGGGAGUUAACUGUACAACCUUCUAGCUUUCCUUGGAGCACACU | ||||||||
MFE | -42.70 kcal/mol | ||||||||
first miRBase version | 7.0 | ||||||||
last miRBase version | 21.0 | ||||||||
Clusters (10 kb) (2 precursors) |
ssc-mir-99a
ssc-let-7c |
||||||||
Family | let-7 (MIPF0000002) | ||||||||
Experiments |
|
||||||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Wernersson et al. | BMC Genomics | 2005 | 15885146 | Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing. |
2 | Reddy et al. | BMC Genomics | 2009 | 19196471 | Cloning, characterization and expression analysis of porcine microRNAs. |
3 | Cho et al. | Mol. Biol. Rep. | 2010 | 20180025 | Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue. |
4 | Nielsen et al. | Anim. Genet. | 2010 | 19917043 | MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing. |
5 | Li et al. | J. Cell. Biochem. | 2011 | 21312241 | MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing. |
6 | Chen et al. | BMC Genomics | 2014 | 24499489 | Exploration of microRNAs in porcine milk exosomes. |