| Accession | MI0002437 | ||||||
| Name | ssc-mir-140 | ||||||
| similar to following miRCarta precursors | ssc-26642-24870.1 | ||||||
| Organism | Sus scrofa | ||||||
| miRNA | ssc-miR-140-5p | ||||||
| miRNA | ssc-miR-140-3p | ||||||
| Sequence (5' -> 3') (70 nts) |
CCUGCCAGUGGUUUUACCCUAUGGUAGGUUACGUCAUGCUGUUCUACCACAGGGUAGAACCACGGACAGG | ||||||
| MFE | -39.10 kcal/mol | ||||||
| first miRBase version | 7.0 | ||||||
| last miRBase version | 21.0 | ||||||
| Family | mir-140 (MIPF0000085) | ||||||
| Experiments |
|
||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Wernersson et al. | BMC Genomics | 2005 | 15885146 | Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing. |
| 2 | Kim et al. | Mamm. Genome | 2008 | 18548309 | Identification and characterization of new microRNAs from pig. |
| 3 | Nielsen et al. | Anim. Genet. | 2010 | 19917043 | MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing. |
| 4 | Chen et al. | BMC Genomics | 2014 | 24499489 | Exploration of microRNAs in porcine milk exosomes. |