Precursor miRBase

ssc-mir-140 (MI0002437)

Accession MI0002437
Name ssc-mir-140
similar to following miRCarta precursors ssc-26642-24870.1
Organism Sus scrofa
miRNA ssc-miR-140-5p
miRNA ssc-miR-140-3p
Sequence (5' -> 3')
(70 nts)
CCUGCCAGUGGUUUUACCCUAUGGUAGGUUACGUCAUGCUGUUCUACCACAGGGUAGAACCACGGACAGG
MFE -39.10 kcal/mol
first miRBase version 7.0
last miRBase version 21.0
Family mir-140 (MIPF0000085)
Experiments
experiment Pubmed link
Illumina 19917043 24499489
cloned 18548309
External DBs
Gene symbol MIR140
NCBI Gene 100316558

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Wernersson et al. BMC Genomics 2005 15885146 Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing.
2 Kim et al. Mamm. Genome 2008 18548309 Identification and characterization of new microRNAs from pig.
3 Nielsen et al. Anim. Genet. 2010 19917043 MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing.
4 Chen et al. BMC Genomics 2014 24499489 Exploration of microRNAs in porcine milk exosomes.