| Accession | MI0002431 | ||||||
| Name | ssc-mir-29b-1 | ||||||
| similar to following miRCarta precursors | ssc-82.1 | ||||||
| Organism | Sus scrofa | ||||||
| Genome | Sscrofa10.2 | ||||||
| Location |
chr18:19,034,822-19,034,902 (+) |
||||||
| miRNA | ssc-miR-29b | ||||||
| Sequence (5' -> 3') (81 nts) |
CUUCAGGAAGCUGGUUUCAUAUGGUGGUUUAGAUUUAAAAAGUGAUUGUCUAGCACCAUUUGAAAUCAGUGUUCUUGGGGG | ||||||
| MFE | -34.10 kcal/mol | ||||||
| first miRBase version | 7.0 | ||||||
| last miRBase version | 21.0 | ||||||
| Clusters (10 kb) (2 precursors) |
ssc-mir-29b-1 ssc-mir-29a |
||||||
| Family | mir-29 (MIPF0000009) | ||||||
| Experiments |
|
||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Wernersson et al. | BMC Genomics | 2005 | 15885146 | Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing. |
| 2 | Cho et al. | Mol. Biol. Rep. | 2010 | 20180025 | Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue. |
| 3 | Nielsen et al. | Anim. Genet. | 2010 | 19917043 | MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing. |
| 4 | Li et al. | J. Cell. Biochem. | 2011 | 21312241 | MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing. |
| 5 | Chen et al. | BMC Genomics | 2014 | 24499489 | Exploration of microRNAs in porcine milk exosomes. |