| Accession | MI0002430 | ||||
| Name | ssc-mir-28 | ||||
| similar to following miRCarta precursors | ssc-25443-28.1 | ||||
| Organism | Sus scrofa | ||||
| Genome | Sscrofa10.2 | ||||
| Location |
chr13:135,461,289-135,461,374 (+) |
||||
| miRNA | ssc-miR-28-5p | ||||
| miRNA | ssc-miR-28-3p | ||||
| Sequence (5' -> 3') (86 nts) |
GGUCCUUGCCCUCAAGGAGCUCACAGUCUAUUGAGUUGCCUUUCUGUCUUCCCCACUAGAUUGUGAGCUCCUGGAGGGCAGGCACU | ||||
| MFE | -47.20 kcal/mol | ||||
| first miRBase version | 7.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
ssc-mir-28 |
||||
| Family | mir-28 (MIPF0000057) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Wernersson et al. | BMC Genomics | 2005 | 15885146 | Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing. |
| 2 | Nielsen et al. | Anim. Genet. | 2010 | 19917043 | MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing. |
| 3 | Li et al. | J. Cell. Biochem. | 2011 | 21312241 | MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing. |
| 4 | Chen et al. | BMC Genomics | 2014 | 24499489 | Exploration of microRNAs in porcine milk exosomes. |