| Accession | MI0002428 | ||||
| Name | ssc-mir-24-1 | ||||
| similar to following miRCarta precursors | ssc-226-35.1 | ||||
| Organism | Sus scrofa | ||||
| Genome | Sscrofa10.2 | ||||
| Location |
chr2:65,582,174-65,582,245 (+) |
||||
| miRNA | ssc-miR-24-1-5p | ||||
| miRNA | ssc-miR-24-3p | ||||
| Sequence (5' -> 3') (72 nts) |
CUCUGCCUCCCGUGCCUACUGAGCUGAAACACAGUUGAUUUGUGCAGACUGGCUCAGUUCAGCAGGAACAGG | ||||
| MFE | -23.60 kcal/mol | ||||
| first miRBase version | 7.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (3 precursors) |
ssc-mir-23a
ssc-mir-27a ssc-mir-24-1 |
||||
| Family | mir-24 (MIPF0000041) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Wernersson et al. | BMC Genomics | 2005 | 15885146 | Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing. |
| 2 | Kim et al. | Mamm. Genome | 2008 | 18548309 | Identification and characterization of new microRNAs from pig. |
| 3 | Cho et al. | Mol. Biol. Rep. | 2010 | 20180025 | Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue. |
| 4 | Nielsen et al. | Anim. Genet. | 2010 | 19917043 | MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing. |
| 5 | Li et al. | J. Cell. Biochem. | 2011 | 21312241 | MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing. |
| 6 | Chen et al. | BMC Genomics | 2014 | 24499489 | Exploration of microRNAs in porcine milk exosomes. |