Precursor miRBase

ssc-mir-23a (MI0002427)

Accession MI0002427
Name ssc-mir-23a
similar to following miRCarta precursors ssc-34373.1
Organism Sus scrofa
Genome Sscrofa10.2
Location chr2:65,581,838-65,581,907 (+)
miRNA ssc-miR-23a
Sequence (5' -> 3')
(70 nts)
CGGCUGGGGUUCCUGGGGAUGGGAUUUGCUGCCUGUCACAAAUCACAUUGCCAGGGAUUUCCAAUCGACC
MFE -29.80 kcal/mol
first miRBase version 7.0
last miRBase version 21.0
Clusters (10 kb)
(3 precursors)
ssc-mir-23a
ssc-mir-27a
ssc-mir-24-1
Family mir-23 (MIPF0000027)
Experiments
experiment Pubmed link
Illumina 21312241 24499489 19917043
cloned 20180025 18548309
External DBs
Gene symbol MIR23A
NCBI Gene 100316598

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Wernersson et al. BMC Genomics 2005 15885146 Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing.
2 Kim et al. Mamm. Genome 2008 18548309 Identification and characterization of new microRNAs from pig.
3 Cho et al. Mol. Biol. Rep. 2010 20180025 Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue.
4 Nielsen et al. Anim. Genet. 2010 19917043 MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing.
5 Li et al. J. Cell. Biochem. 2011 21312241 MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing.
6 Chen et al. BMC Genomics 2014 24499489 Exploration of microRNAs in porcine milk exosomes.