| Accession | MI0002424 | ||||||
| Name | ssc-mir-216-1 | ||||||
| similar to following miRCarta precursors | ssc-778.1 | ||||||
| Organism | Sus scrofa | ||||||
| Genome | Sscrofa10.2 | ||||||
| Location |
chr3:90,058,975-90,059,079 (+) |
||||||
| miRNA | ssc-miR-216 | ||||||
| Sequence (5' -> 3') (105 nts) |
GAUGGCUGUGAGUUGGCUUAAUCUCAGCUGGCAACUGUGAGAUGUUCAUACAAUCCCCCACAGUGGUCUCUGGGAUUAUGCUAAACAGAGCAAUUUCCUUGCCCU | ||||||
| MFE | -35.80 kcal/mol | ||||||
| first miRBase version | 7.0 | ||||||
| last miRBase version | 21.0 | ||||||
| Clusters (10 kb) (2 precursors) |
ssc-mir-216-1 ssc-mir-217-1 |
||||||
| Family | mir-216 (MIPF0000054) | ||||||
| Experiments |
|
||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Wernersson et al. | BMC Genomics | 2005 | 15885146 | Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing. |
| 2 | Reddy et al. | BMC Genomics | 2009 | 19196471 | Cloning, characterization and expression analysis of porcine microRNAs. |
| 3 | Li et al. | J. Cell. Biochem. | 2011 | 21312241 | MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing. |