Accession | MI0002405 | ||||||
Name | mmu-mir-470 | ||||||
similar to following miRCarta precursors | mmu-25686-25685.1 | ||||||
Organism | Mus musculus | ||||||
Genome | GRCm38.p5 | ||||||
Location |
chrX:66,813,951-66,814,025 (-) |
||||||
miRNA | mmu-miR-470-5p | ||||||
miRNA | mmu-miR-470-3p | ||||||
Sequence (5' -> 3') (75 nts) |
CAGUGCUCUUCUUGGACUGGCACUGGUGAGUUAAACUAAAUACAACCAGUACCUUUCUGAGAAGAGUAAAGCUCA | ||||||
MFE | -29.00 kcal/mol | ||||||
first miRBase version | 7.0 | ||||||
last miRBase version | 21.0 | ||||||
Clusters (10 kb) (3 precursors) |
mmu-mir-871
mmu-mir-470 mmu-mir-465d |
||||||
Family | mir-743 (MIPF0000386) | ||||||
Experiments |
|
||||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Yu et al. | Biol. Reprod. | 2005 | 15901636 | MicroRNA Mirn122a reduces expression of the posttranscriptionally regulated germ cell transition protein 2 (Tnp2) messenger RNA (mRNA) by mRNA cleavage. |
2 | Watanabe et al. | Genes Dev. | 2006 | 16766679 | Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes. |
3 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
4 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |
5 | Ahn et al. | Mol. Hum. Reprod. | 2010 | 20215419 | MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. |