| Accession | MI0002401 | ||||||
| Name | mmu-mir-466a | ||||||
| similar to following miRCarta precursors | mmu-24267-24251.1 | ||||||
| Organism | Mus musculus | ||||||
| Genome | GRCm38.p5 | ||||||
| Location |
chr2:10,507,918-10,507,990 (+) |
||||||
| miRNA | mmu-miR-466a-5p | ||||||
| miRNA | mmu-miR-466a-3p | ||||||
| Sequence (5' -> 3') (73 nts) |
UAUAUGUGUUUAUGUGUGUGUACAUGUACAUAUGUGAAUAUGAUAUCCAUAUACAUACACGCACACAUAAGAC | ||||||
| MFE | -22.70 kcal/mol | ||||||
| first miRBase version | 7.0 | ||||||
| last miRBase version | 21.0 | ||||||
| Clusters (10 kb) (26 precursors) |
mmu-mir-467a-9
mmu-mir-466b-2 mmu-mir-669a-10 mmu-mir-669a-11 mmu-mir-467a-10 mmu-mir-466b-3 mmu-mir-669a-12 mmu-mir-467e mmu-mir-466p mmu-mir-467d mmu-mir-466a mmu-mir-297c mmu-mir-669c mmu-mir-669a-2 mmu-mir-297b mmu-mir-466d mmu-mir-669m-1 mmu-mir-669m-2 mmu-mir-466n mmu-mir-669o mmu-mir-466g mmu-mir-466h mmu-mir-297a-3 mmu-mir-466l mmu-mir-297a-4 mmu-mir-669i |
||||||
| Family | mir-466 (MIPF0000208) | ||||||
| Experiments |
|
||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Yu et al. | Biol. Reprod. | 2005 | 15901636 | MicroRNA Mirn122a reduces expression of the posttranscriptionally regulated germ cell transition protein 2 (Tnp2) messenger RNA (mRNA) by mRNA cleavage. |
| 2 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 3 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |
| 4 | Ahn et al. | Mol. Hum. Reprod. | 2010 | 20215419 | MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. |