| Accession | MI0001973 | ||||
| Name | dre-mir-125a-2 | ||||
| similar to following miRCarta precursors | dre-26025.1 | ||||
| Organism | Danio rerio | ||||
| Genome | Zv9 | ||||
| Location |
19:10,066,308-10,066,414 (+) |
||||
| miRNA | dre-miR-125a | ||||
| Sequence (5' -> 3') (107 nts) |
GAUCAGUCCAAAUCGAUGUAUGUCUGUGUCCCUGAGACCCUUAACCUGUGAUGUCUUCCAAGGUCACAGGUGAGGUCCUUGGGAACACGGCUGUAUAUGAUGACGUC | ||||
| MFE | -41.50 kcal/mol | ||||
| first miRBase version | 7.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
dre-mir-125a-2 |
||||
| Family | mir-10 (MIPF0000033) | ||||
| Experiments |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Chen et al. | Genes Dev. | 2005 | 15937218 | The developmental miRNA profiles of zebrafish as determined by small RNA cloning. |