| Accession | MI0001731 | ||||
| Name | rno-mir-451 | ||||
| similar to following miRCarta precursors | rno-83-29589.1 | ||||
| Organism | Rattus norvegicus | ||||
| Genome | Rnor_5.0 | ||||
| Location |
chr10:66,340,853-66,340,924 (+) |
||||
| miRNA | rno-miR-451-5p | ||||
| miRNA | rno-miR-451-3p | ||||
| Sequence (5' -> 3') (72 nts) |
UUUGGGAAUGGCGAGGAAACCGUUACCAUUACUGAGUUUAGUAAUGGUAAUGGUUCUCUUGCUGCUCCCACA | ||||
| MFE | -41.50 kcal/mol | ||||
| first miRBase version | 7.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
rno-mir-144
rno-mir-451 |
||||
| Family | mir-451 (MIPF0000148) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Altuvia et al. | Nucleic Acids Res. | 2005 | 15891114 | Clustering and conservation patterns of human microRNAs. |
| 2 | Watanabe et al. | Genes Dev. | 2006 | 16766679 | Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes. |
| 3 | Linsen et al. | BMC Genomics | 2010 | 20403161 | Small RNA expression and strain specificity in the rat. |