| Accession | MI0001730 | ||||||
| Name | mmu-mir-451a | ||||||
| similar to following miRCarta precursors | mmu-83.1 | ||||||
| Organism | Mus musculus | ||||||
| Genome | GRCm38.p5 | ||||||
| Location |
chr11:78,073,170-78,073,241 (+) |
||||||
| miRNA | mmu-miR-451a | ||||||
| Sequence (5' -> 3') (72 nts) |
CUUGGGAAUGGCGAGGAAACCGUUACCAUUACUGAGUUUAGUAAUGGUAACGGUUCUCUUGCUGCUCCCACA | ||||||
| MFE | -43.30 kcal/mol | ||||||
| first miRBase version | 7.0 | ||||||
| last miRBase version | 21.0 | ||||||
| Clusters (10 kb) (3 precursors) |
mmu-mir-144
mmu-mir-451a mmu-mir-451b |
||||||
| Family | mir-451 (MIPF0000148) | ||||||
| Experiments |
|
||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Sewer et al. | BMC Bioinformatics | 2005 | 16274478 | Identification of clustered microRNAs using an ab initio prediction method. |
| 2 | Altuvia et al. | Nucleic Acids Res. | 2005 | 15891114 | Clustering and conservation patterns of human microRNAs. |
| 3 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 4 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |
| 5 | Ahn et al. | Mol. Hum. Reprod. | 2010 | 20215419 | MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. |