Accession | MI0001725 | ||||
Name | hsa-mir-329-1 | ||||
similar to following miRCarta precursors | hsa-1247-586.1 | ||||
Organism | Homo sapiens | ||||
Genome | GRCh38.p10 | ||||
Location |
chr14:101,026,785-101,026,864 (+) |
||||
miRNA | hsa-miR-329-5p | ||||
miRNA | hsa-miR-329-3p | ||||
Sequence (5' -> 3') (80 nts) |
GGUACCUGAAGAGAGGUUUUCUGGGUUUCUGUUUCUUUAAUGAGGACGAAACACACCUGGUUAACCUCUUUUCCAGUAUC | ||||
MFE | -32.60 kcal/mol | ||||
first miRBase version | 7.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (13 precursors) |
hsa-mir-379
hsa-mir-411 hsa-mir-299 hsa-mir-380 hsa-mir-1197 hsa-mir-323a hsa-mir-758 hsa-mir-329-1 hsa-mir-329-2 hsa-mir-494 hsa-mir-1193 hsa-mir-543 hsa-mir-495 |
||||
Family | mir-329 (MIPF0000110) | ||||
Experiments |
|
||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Sewer et al. | BMC Bioinformatics | 2005 | 16274478 | Identification of clustered microRNAs using an ab initio prediction method. |
2 | Bentwich et al. | Nat. Genet. | 2005 | 15965474 | Identification of hundreds of conserved and nonconserved human microRNAs. |
3 | Altuvia et al. | Nucleic Acids Res. | 2005 | 15891114 | Clustering and conservation patterns of human microRNAs. |
4 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
5 | Meunier et al. | Genome Res. | 2013 | 23034410 | Birth and expression evolution of mammalian microRNA genes. |