| Accession | MI0001724 | ||||
| Name | rno-mir-433 | ||||
| similar to following miRCarta precursors | rno-977-533.1 | ||||
| Organism | Rattus norvegicus | ||||
| Genome | Rnor_5.0 | ||||
| Location |
chr6:142,874,511-142,874,603 (+) |
||||
| miRNA | rno-miR-433-5p | ||||
| miRNA | rno-miR-433-3p | ||||
| Sequence (5' -> 3') (93 nts) |
CCGGGGAGAAGUACGGUGAGCCUGUCAUUAUUCAGAGAGGCUAGAUCCUCUGUGUUGAGAAGGAUCAUGAUGGGCUCCUCGGUGUUCUCCAGG | ||||
| MFE | -38.40 kcal/mol | ||||
| first miRBase version | 7.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (12 precursors) |
rno-mir-337
rno-mir-3544 rno-mir-540 rno-mir-665 rno-mir-431 rno-mir-433 rno-mir-127 rno-mir-3543-1 rno-mir-434-1 rno-mir-3543-2 rno-mir-434-2 rno-mir-136 |
||||
| Family | mir-433 (MIPF0000177) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Altuvia et al. | Nucleic Acids Res. | 2005 | 15891114 | Clustering and conservation patterns of human microRNAs. |
| 2 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 3 | Linsen et al. | BMC Genomics | 2010 | 20403161 | Small RNA expression and strain specificity in the rat. |