| Accession | MI0001519 | ||||
| Name | hsa-mir-20b | ||||
| similar to following miRCarta precursors | hsa-241-641.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chrX:134,169,809-134,169,877 (-) |
||||
| miRNA | hsa-miR-20b-5p | ||||
| miRNA | hsa-miR-20b-3p | ||||
| Sequence (5' -> 3') (69 nts) |
AGUACCAAAGUGCUCAUAGUGCAGGUAGUUUUGGCAUGACUCUACUGUAGUAUGGGCACUUCCAGUACU | ||||
| MFE | -29.60 kcal/mol | ||||
| first miRBase version | 7.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (6 precursors) |
hsa-mir-363
hsa-mir-92a-2 hsa-mir-19b-2 hsa-mir-20b hsa-mir-18b hsa-mir-106a |
||||
| Family | mir-17 (MIPF0000001) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | O'Donnell et al. | Nature | 2005 | 15944709 | c-Myc-regulated microRNAs modulate E2F1 expression. |
| 2 | Sewer et al. | BMC Bioinformatics | 2005 | 16274478 | Identification of clustered microRNAs using an ab initio prediction method. |
| 3 | Bentwich et al. | Nat. Genet. | 2005 | 15965474 | Identification of hundreds of conserved and nonconserved human microRNAs. |
| 4 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 5 | Lui et al. | Cancer Res. | 2007 | 17616659 | Patterns of known and novel small RNAs in human cervical cancer. |