| Accession | MI0001655 | ||||
| Name | cfa-mir-450a | ||||
| similar to following miRCarta precursors | cfa-32215.1 | ||||
| Organism | Canis familiaris | ||||
| Genome | CanFam3.1 | ||||
| Location |
chrX:105,177,439-105,177,529 (-) |
||||
| miRNA | cfa-miR-450a | ||||
| Sequence (5' -> 3') (91 nts) |
GAAAGAUGCUGAACUGUUUUUGCGAUGUGUUCCUAAUAUGCAGUAUGAACAUAUUGGGAGCAUUUUGCAUGCAUGGUUUUGUAUCAAUAUA | ||||
| MFE | -35.40 kcal/mol | ||||
| first miRBase version | 6.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (5 precursors) |
cfa-mir-450b
cfa-mir-450a cfa-mir-542 cfa-mir-503 cfa-mir-424 |
||||
| Family | mir-450 (MIPF0000128) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Xie et al. | Nature | 2005 | 15735639 | Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals. |