| Accession | MI0001651 | ||||
| Name | cfa-mir-449a | ||||
| similar to following miRCarta precursors | cfa-25304.1 | ||||
| Organism | Canis familiaris | ||||
| Genome | CanFam3.1 | ||||
| Location |
chr2:42,541,949-42,542,039 (-) |
||||
| miRNA | cfa-miR-449a | ||||
| Sequence (5' -> 3') (91 nts) |
CCGUGUGUGAUGGGUUGGCAGUGUAUUGUUAGCUGGUUGAAUAUAUGAAUGGCAUCAGCUAACAUGCAACUGCUAUCUUAUUGCAUAUACA | ||||
| MFE | -38.50 kcal/mol | ||||
| first miRBase version | 6.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
cfa-mir-449a cfa-mir-449b |
||||
| Family | mir-449 (MIPF0000133) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Xie et al. | Nature | 2005 | 15735639 | Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals. |