| Accession | MI0001643 | ||||||
| Name | rno-mir-429 | ||||||
| similar to following miRCarta precursors | rno-24522.1 | ||||||
| Organism | Rattus norvegicus | ||||||
| Genome | Rnor_5.0 | ||||||
| Location |
chr5:176,962,353-176,962,437 (-) |
||||||
| miRNA | rno-miR-429 | ||||||
| Sequence (5' -> 3') (85 nts) |
UGCCUGCUGAUGGAUGUCUUACCAGACAUGGUUAGAUCUGGAUGUAUCUGUCUAAUACUGUCUGGUAAUGCCGUCCAUCCAUGGC | ||||||
| MFE | -35.30 kcal/mol | ||||||
| first miRBase version | 6.0 | ||||||
| last miRBase version | 21.0 | ||||||
| Clusters (10 kb) (4 precursors) |
rno-mir-429 rno-mir-3548 rno-mir-200a rno-mir-200b |
||||||
| Family | mir-8 (MIPF0000019) | ||||||
| Experiments |
|
||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Xie et al. | Nature | 2005 | 15735639 | Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals. |
| 2 | Watanabe et al. | Genes Dev. | 2006 | 16766679 | Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes. |