Precursor miRBase

mmu-mir-429 (MI0001642)

Accession MI0001642
Name mmu-mir-429
similar to following miRCarta precursors mmu-24523-24522.1
Organism Mus musculus
Genome GRCm38.p5
Location chr4:156,053,905-156,053,987 (-)
miRNA mmu-miR-429-5p
miRNA mmu-miR-429-3p
Sequence (5' -> 3')
(83 nts)
CCUGCUGAUGGAUGUCUUACCAGACAUGGUUAGAUCUGGAUGCAUCUGUCUAAUACUGUCUGGUAAUGCCGUCCAUCCACGGC
MFE -33.70 kcal/mol
first miRBase version 6.0
last miRBase version 21.0
Clusters (10 kb)
(3 precursors)
mmu-mir-429
mmu-mir-200a
mmu-mir-200b
Family mir-8 (MIPF0000019)
Experiments
experiment Pubmed link
Illumina 20413612
External DBs
Gene symbol Mir429
NCBI Gene 723865

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Xie et al. Nature 2005 15735639 Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals.
2 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
3 Chiang et al. Genes Dev. 2010 20413612 Mammalian microRNAs: experimental evaluation of novel and previously annotated genes.
4 Ahn et al. Mol. Hum. Reprod. 2010 20215419 MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing.