| Accession | MI0001600 | ||||
| Name | aga-let-7 | ||||
| similar to following miRCarta precursors | aga-42942.1 | ||||
| potential naming conflicts with | aga-let-7 (MIMAT0001495) | ||||
| Organism | Anopheles gambiae | ||||
| Genome | AgamP3 | ||||
| Location |
chr3R:10,270,708-10,270,797 (-) |
||||
| miRNA | aga-let-7 | ||||
| Sequence (5' -> 3') (90 nts) |
GCCUACUCCCGUGUUGAGGUAGUUGGUUGUAUAGUACCGUGGUUCCAAUACUCGACUAUACAAUCCGCUAACUUACCUCGUGGGUAGAGU | ||||
| MFE | -31.00 kcal/mol | ||||
| first miRBase version | 6.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (3 precursors) |
aga-mir-125
aga-let-7 aga-mir-100 |
||||
| Family | let-7 (MIPF0000002) | ||||
| Experiments |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Winter et al. | Nucleic Acids Res. | 2007 | 17933784 | Anopheles gambiae miRNAs as actors of defence reaction against Plasmodium invasion. |