Precursor miRBase

hsa-mir-365b (MI0000769)

Accession MI0000769
Name hsa-mir-365b
similar to following miRCarta precursors hsa-644-175.1
Organism Homo sapiens
Genome GRCh38.p10
Location chr17:31,575,411-31,575,521 (+)
miRNA hsa-miR-365b-5p
miRNA hsa-miR-365b-3p
Sequence (5' -> 3')
(111 nts)
AGAGUGUUCAAGGACAGCAAGAAAAAUGAGGGACUUUCAGGGGCAGCUGUGUUUUCUGACUCAGUCAUAAUGCCCCUAAAAAUCCUUAUUGUUCUUGCAGUGUGCAUCGGG
MFE -38.40 kcal/mol
first miRBase version 6.0
last miRBase version 21.0
Clusters (10 kb)
(2 precursors)
hsa-mir-4725
hsa-mir-365b
Family mir-365 (MIPF0000061)
Experiments
experiment Pubmed link
cloned 17616659 15735639 17604727
microarray 15965474
External DBs
Gene symbol MIR365B
NCBI Gene 100126356

External tools

Links
HMDD

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Xie et al. Nature 2005 15735639 Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals.
2 Bentwich et al. Nat. Genet. 2005 15965474 Identification of hundreds of conserved and nonconserved human microRNAs.
3 Lui et al. Cancer Res. 2007 17616659 Patterns of known and novel small RNAs in human cervical cancer.
4 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
5 Zhu et al. J. Virol. 2009 19144710 Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas.