| Accession | MI0000769 | ||||||
| Name | hsa-mir-365b | ||||||
| similar to following miRCarta precursors | hsa-644-175.1 | ||||||
| Organism | Homo sapiens | ||||||
| Genome | GRCh38.p10 | ||||||
| Location |
chr17:31,575,411-31,575,521 (+) |
||||||
| miRNA | hsa-miR-365b-5p | ||||||
| miRNA | hsa-miR-365b-3p | ||||||
| Sequence (5' -> 3') (111 nts) |
AGAGUGUUCAAGGACAGCAAGAAAAAUGAGGGACUUUCAGGGGCAGCUGUGUUUUCUGACUCAGUCAUAAUGCCCCUAAAAAUCCUUAUUGUUCUUGCAGUGUGCAUCGGG | ||||||
| MFE | -38.40 kcal/mol | ||||||
| first miRBase version | 6.0 | ||||||
| last miRBase version | 21.0 | ||||||
| Clusters (10 kb) (2 precursors) |
hsa-mir-4725
hsa-mir-365b |
||||||
| Family | mir-365 (MIPF0000061) | ||||||
| Experiments |
|
||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Xie et al. | Nature | 2005 | 15735639 | Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals. |
| 2 | Bentwich et al. | Nat. Genet. | 2005 | 15965474 | Identification of hundreds of conserved and nonconserved human microRNAs. |
| 3 | Lui et al. | Cancer Res. | 2007 | 17616659 | Patterns of known and novel small RNAs in human cervical cancer. |
| 4 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 5 | Zhu et al. | J. Virol. | 2009 | 19144710 | Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas. |