Precursor miRBase

hsa-mir-365a (MI0000767)

Accession MI0000767
Name hsa-mir-365a
similar to following miRCarta precursors hsa-595-176.1
Organism Homo sapiens
Genome GRCh38.p10
Location chr16:14,309,285-14,309,371 (+)
miRNA hsa-miR-365a-5p
miRNA hsa-miR-365a-3p
Sequence (5' -> 3')
(87 nts)
ACCGCAGGGAAAAUGAGGGACUUUUGGGGGCAGAUGUGUUUCCAUUCCACUAUCAUAAUGCCCCUAAAAAUCCUUAUUGCUCUUGCA
MFE -34.50 kcal/mol
first miRBase version 6.0
last miRBase version 21.0
Clusters (10 kb)
(2 precursors)
hsa-mir-193b
hsa-mir-365a
Family mir-365 (MIPF0000061)
External DBs
Gene symbol MIR365A
NCBI Gene 100126355

External tools

Links
HMDD

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Xie et al. Nature 2005 15735639 Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals.
2 Bentwich et al. Nat. Genet. 2005 15965474 Identification of hundreds of conserved and nonconserved human microRNAs.
3 Lui et al. Cancer Res. 2007 17616659 Patterns of known and novel small RNAs in human cervical cancer.
4 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.