| Accession | MI0001445 | ||||||||
| Name | hsa-mir-423 | ||||||||
| similar to following miRCarta precursors | hsa-141-100.1 | ||||||||
| Organism | Homo sapiens | ||||||||
| Genome | GRCh38.p10 | ||||||||
| Location |
chr17:30,117,079-30,117,172 (+) |
||||||||
| miRNA | hsa-miR-423-5p | ||||||||
| miRNA | hsa-miR-423-3p | ||||||||
| Sequence (5' -> 3') (94 nts) |
AUAAAGGAAGUUAGGCUGAGGGGCAGAGAGCGAGACUUUUCUAUUUUCCAAAAGCUCGGUCUGAGGCCCCUCAGUCUUGCUUCCUAACCCGCGC | ||||||||
| MFE | -48.80 kcal/mol | ||||||||
| first miRBase version | 5.1 | ||||||||
| last miRBase version | 21.0 | ||||||||
| Clusters (10 kb) (2 precursors) |
hsa-mir-423 hsa-mir-3184 |
||||||||
| Family | mir-423 (MIPF0000329) | ||||||||
| Experiments |
|
||||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Kasashima et al. | Biochem. Biophys. Res. Commun. | 2004 | 15325244 | Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells. |
| 2 | Lui et al. | Cancer Res. | 2007 | 17616659 | Patterns of known and novel small RNAs in human cervical cancer. |
| 3 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 4 | Afanasyeva et al. | BMC Genomics | 2008 | 18230126 | New miRNAs cloned from neuroblastoma. |
| 5 | Koh et al. | BMC Genomics | 2010 | 20158877 | Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha. |