Precursor miRBase

hsa-mir-423 (MI0001445)

Accession MI0001445
Name hsa-mir-423
similar to following miRCarta precursors hsa-141-100.1
Organism Homo sapiens
Genome GRCh38.p10
Location chr17:30,117,079-30,117,172 (+)
miRNA hsa-miR-423-5p
miRNA hsa-miR-423-3p
Sequence (5' -> 3')
(94 nts)
AUAAAGGAAGUUAGGCUGAGGGGCAGAGAGCGAGACUUUUCUAUUUUCCAAAAGCUCGGUCUGAGGCCCCUCAGUCUUGCUUCCUAACCCGCGC
MFE -48.80 kcal/mol
first miRBase version 5.1
last miRBase version 21.0
Clusters (10 kb)
(2 precursors)
hsa-mir-423
hsa-mir-3184
Family mir-423 (MIPF0000329)
Experiments
experiment Pubmed link
Illumina 20158877
cloned 17616659 18230126 17604727
Northern blot 18230126
External DBs
Gene symbol MIR423
NCBI Gene 494335

External tools

Links
HMDD

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Kasashima et al. Biochem. Biophys. Res. Commun. 2004 15325244 Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells.
2 Lui et al. Cancer Res. 2007 17616659 Patterns of known and novel small RNAs in human cervical cancer.
3 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
4 Afanasyeva et al. BMC Genomics 2008 18230126 New miRNAs cloned from neuroblastoma.
5 Koh et al. BMC Genomics 2010 20158877 Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha.