Accession | MI0000798 | ||||
Name | mmu-mir-381 | ||||
similar to following miRCarta precursors | mmu-818-161.1 | ||||
Organism | Mus musculus | ||||
Genome | GRCm38.p5 | ||||
Location |
chr12:109,726,822-109,726,896 (+) |
||||
miRNA | mmu-miR-381-5p | ||||
miRNA | mmu-miR-381-3p | ||||
Sequence (5' -> 3') (75 nts) |
UACUUAAAGCGAGGUUGCCCUUUGUAUAUUCGGUUUAUUGACAUGGAAUAUACAAGGGCAAGCUCUCUGUGAGUA | ||||
MFE | -35.50 kcal/mol | ||||
first miRBase version | 5.1 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (18 precursors) |
mmu-mir-666
mmu-mir-543 mmu-mir-495 mmu-mir-667 mmu-mir-376c mmu-mir-654 mmu-mir-376b mmu-mir-376a mmu-mir-300 mmu-mir-381 mmu-mir-487b mmu-mir-539 mmu-mir-544 mmu-mir-382 mmu-mir-134 mmu-mir-668 mmu-mir-485 mmu-mir-453 |
||||
Family | mir-154 (MIPF0000018) | ||||
Experiments |
|
||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Poy et al. | Nature | 2004 | 15538371 | A pancreatic islet-specific microRNA regulates insulin secretion. |
2 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
3 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |
4 | Ahn et al. | Mol. Hum. Reprod. | 2010 | 20215419 | MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. |