| Accession | MI0000791 | ||||
| Name | hsa-mir-383 | ||||
| similar to following miRCarta precursors | hsa-862-1756.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr8:14,853,438-14,853,510 (-) |
||||
| miRNA | hsa-miR-383-5p | ||||
| miRNA | hsa-miR-383-3p | ||||
| Sequence (5' -> 3') (73 nts) |
CUCCUCAGAUCAGAAGGUGAUUGUGGCUUUGGGUGGAUAUUAAUCAGCCACAGCACUGCCUGGUCAGAAAGAG | ||||
| MFE | -28.10 kcal/mol | ||||
| first miRBase version | 5.1 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
hsa-mir-383 |
||||
| Family | mir-383 (MIPF0000137) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Poy et al. | Nature | 2004 | 15538371 | A pancreatic islet-specific microRNA regulates insulin secretion. |
| 2 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 3 | Meunier et al. | Genome Res. | 2013 | 23034410 | Birth and expression evolution of mammalian microRNA genes. |