| Accession | MI0000789 | ||||
| Name | hsa-mir-381 | ||||
| similar to following miRCarta precursors | hsa-818-161.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr14:101,045,920-101,045,994 (+) |
||||
| miRNA | hsa-miR-381-5p | ||||
| miRNA | hsa-miR-381-3p | ||||
| Sequence (5' -> 3') (75 nts) |
UACUUAAAGCGAGGUUGCCCUUUGUAUAUUCGGUUUAUUGACAUGGAAUAUACAAGGGCAAGCUCUCUGUGAGUA | ||||
| MFE | -35.50 kcal/mol | ||||
| first miRBase version | 5.1 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (19 precursors) |
hsa-mir-376c
hsa-mir-376a-2 hsa-mir-654 hsa-mir-376b hsa-mir-376a-1 hsa-mir-300 hsa-mir-1185-1 hsa-mir-1185-2 hsa-mir-381 hsa-mir-487b hsa-mir-539 hsa-mir-889 hsa-mir-544a hsa-mir-655 hsa-mir-487a hsa-mir-382 hsa-mir-134 hsa-mir-668 hsa-mir-485 |
||||
| Family | mir-154 (MIPF0000018) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Sewer et al. | BMC Bioinformatics | 2005 | 16274478 | Identification of clustered microRNAs using an ab initio prediction method. |
| 2 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 3 | Voellenkle et al. | RNA | 2012 | 22282338 | Deep-sequencing of endothelial cells exposed to hypoxia reveals the complexity of known and novel microRNAs. |