Accession | MI0000788 | ||||
Name | hsa-mir-380 | ||||
similar to following miRCarta precursors | hsa-762-960.1 | ||||
Organism | Homo sapiens | ||||
Genome | GRCh38.p10 | ||||
Location |
chr14:101,025,017-101,025,077 (+) |
||||
miRNA | hsa-miR-380-5p | ||||
miRNA | hsa-miR-380-3p | ||||
Sequence (5' -> 3') (61 nts) |
AAGAUGGUUGACCAUAGAACAUGCGCUAUCUCUGUGUCGUAUGUAAUAUGGUCCACAUCUU | ||||
MFE | -24.50 kcal/mol | ||||
first miRBase version | 5.1 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (13 precursors) |
hsa-mir-379
hsa-mir-411 hsa-mir-299 hsa-mir-380 hsa-mir-1197 hsa-mir-323a hsa-mir-758 hsa-mir-329-1 hsa-mir-329-2 hsa-mir-494 hsa-mir-1193 hsa-mir-543 hsa-mir-495 |
||||
Family | mir-379 (MIPF0000126) | ||||
Experiments |
|
||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Seitz et al. | Genome Res. | 2004 | 15310658 | A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain. |
2 | Poy et al. | Nature | 2004 | 15538371 | A pancreatic islet-specific microRNA regulates insulin secretion. |
3 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |