| Accession | MI0001267 |
| Name | gga-mir-205a |
| similar to following miRCarta precursors | gga-351.1 |
| Organism | Gallus gallus |
| Genome | Gallus-gallus-4.0 |
| Location |
chr26:3,017,914-3,018,009 (+) |
| miRNA | gga-miR-205a |
| Sequence (5' -> 3') (96 nts) |
GACAAUCCAUGGGUUCUGUUGUCCUUCAUUCCACCGGAGUCUGUCUCGUACCUAACCAGAUUUCAGUGGAGUGAAGCACAAGAGACAUGGAGAUGA |
| MFE | -41.70 kcal/mol |
| first miRBase version | 4.0 |
| last miRBase version | 21.0 |
| Clusters (10 kb) (1 precursors) |
gga-mir-205a |
| Family | mir-205 (MIPF0000058) |
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Hillier et al. | Nature | 2004 | 15592404 | Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution. |